View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21657_high_37 (Length: 210)
Name: NF21657_high_37
Description: NF21657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21657_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 36 - 173
Target Start/End: Complemental strand, 32317181 - 32317044
Alignment:
| Q |
36 |
aggtgctatatcagtgctgcaattacacatgaaaataaaataaatatcatgaacacaaacgcatgcacgtagnnnnnnnnngttttgcctaaaaatgtga |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32317181 |
aggtgctatatcagtgctgcaattacacatgaaaataaaataaatatcatgaacacaaacgcatgcacgtagtttttttttgttttgcctaaaaatgtga |
32317082 |
T |
|
| Q |
136 |
agcattggttgaatatagagacattcacatgatagtag |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32317081 |
agcattggttgaatatagagacattcacatgatagtag |
32317044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University