View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21657_low_10 (Length: 482)
Name: NF21657_low_10
Description: NF21657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21657_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 318; Significance: 1e-179; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 152 - 477
Target Start/End: Complemental strand, 9234302 - 9233977
Alignment:
| Q |
152 |
ttttcaacttcgacatgcaaaatggtagacccgatcccaacaactagaaccattaatttaatctctctttttcatcaattccattcacacaccctccatt |
251 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9234302 |
ttttcaacctcgacatgcaaaatggtagacccgatcccaacaactagaaccattaatttaatctctctttttcatcaattccattcacacaccctccatt |
9234203 |
T |
 |
| Q |
252 |
gttttaagcttcagatttctcaactggaacttcttctgctgctggagcttccactgactcaactggtttaacattctcttcctcagcagttactgctgct |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9234202 |
gttttaagcttcagatttctcaactggaacttcttctgctgctggagcttccactgactcaactggtttaacattctcttcctcagcagttactgctgct |
9234103 |
T |
 |
| Q |
352 |
ggtgcttctgactcattttcaatggttgctacaggctcctccactactgctgcagcctcttccttcacttcttcaactgattcctctgtttctttaggtg |
451 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9234102 |
ggtgcttctgactcattttcaatggttgctacaggctcctccactactgctgcagcctcttccttcacttcttcaactgattcctctgtttctttaggtg |
9234003 |
T |
 |
| Q |
452 |
cttctgtattctcttcctttgcttct |
477 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
9234002 |
cttctgtattctcttccttggcttct |
9233977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 9234431 - 9234363
Alignment:
| Q |
23 |
aaagttccatacataactgatgtagatagctataccctccatatgaataaccatttccaaagacttact |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9234431 |
aaagttccatacataactgatgtagatagctataccctccatatgaataaccatttccaaagacttact |
9234363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University