View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21657_low_31 (Length: 249)
Name: NF21657_low_31
Description: NF21657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21657_low_31 |
 |  |
|
| [»] scaffold0153 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 8e-36; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 140 - 235
Target Start/End: Complemental strand, 32618241 - 32618145
Alignment:
| Q |
140 |
ctatgaattttgtttatggcaagggagtttaatttgtttgtgaatgaagatgcctcaaaattttgatgttag-ttagttttataatacaatatcgta |
235 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
32618241 |
ctatgagttttgtttatggcaggggagtttaatttgtttgtgaatgaagatgcctcaaaattttgatgttagtttagttttataatataatatcgta |
32618145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 7 - 73
Target Start/End: Original strand, 14604550 - 14604616
Alignment:
| Q |
7 |
tacattattctatctttttggttatgaactttcttacttacgatcattgttaatctctctatagctt |
73 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
14604550 |
tacattcttctatctttttggttatgaaccttcttacttacaatcgttgttaatctctctatagctt |
14604616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 194
Target Start/End: Original strand, 14604684 - 14604738
Alignment:
| Q |
140 |
ctatgaattttgtttatggcaagggagtttaatttgtttgtgaatgaagatgcct |
194 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
14604684 |
ctatgaattttgtttatggtatgggagtttaatttgtttgtgaatgaagatgcct |
14604738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 14 - 74
Target Start/End: Complemental strand, 32618365 - 32618305
Alignment:
| Q |
14 |
ttctatctttttggttatgaactttcttacttacgatcattgttaatctctctatagcttc |
74 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
32618365 |
ttctatcttttttgttatgaaccttcttacttacaatcgttgttaatctctctatagcttc |
32618305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 140 - 223
Target Start/End: Complemental strand, 51271030 - 51270946
Alignment:
| Q |
140 |
ctatgaattttgtttatggcaagggagtttaatttgtttgtgaatgaagatgcctcaaaattttgatgttag-ttagttttataa |
223 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51271030 |
ctatgatttttgtttgtggcaggggagtttaatttgtttatgaatgaagatgcctcaaaattttgatgttagtttagttttataa |
51270946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 202
Target Start/End: Complemental strand, 22774523 - 22774461
Alignment:
| Q |
140 |
ctatgaattttgtttatggcaagggagtttaatttgtttgtgaatgaagatgcctcaaaattt |
202 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22774523 |
ctatgatttttgtttgtggcaggggagtttaatttgtttatgaatgaagatgcctcaaaattt |
22774461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0153 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0153
Description:
Target: scaffold0153; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 192
Target Start/End: Original strand, 36137 - 36189
Alignment:
| Q |
140 |
ctatgaattttgtttatggcaagggagtttaatttgtttgtgaatgaagatgc |
192 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
36137 |
ctatgatttttgtttgtggcaggggagtttaatttgtttatgaatgaagatgc |
36189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University