View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21658_high_21 (Length: 237)
Name: NF21658_high_21
Description: NF21658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21658_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 30688805 - 30689020
Alignment:
| Q |
1 |
tcaaagtagtgagtttaacaccattttaaaaccttaatgaaggttaggatcaggttaatttcactcttattgtctccttcactaattaaggttatgaact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30688805 |
tcaaagtagtgagtttaacaccattttaaaaccttaagtaaggttaggatcagtttaatttcactcttattgtctctttcactaattaaggttatgaact |
30688904 |
T |
 |
| Q |
101 |
aatataggacttcatggctcacacttgaatttcacacacnnnnnnncctgcctgagtattattatttcacacttcatggctcactcttatacggaacaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30688905 |
aatataggacttcatggctcacacttgaatttcacacacaaaaaaacctgcctgagtattattatttcacacttcatggctcactcttatacggaacaat |
30689004 |
T |
 |
| Q |
201 |
aagaattaacccactt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30689005 |
aagaattaacccactt |
30689020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University