View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21658_low_18 (Length: 263)
Name: NF21658_low_18
Description: NF21658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21658_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 11417678 - 11417509
Alignment:
| Q |
18 |
atacatgtctatttaaggggttaccatcaaacagaaagaaggcttgatagaacgatttgcaaccaacttcggatcaactcatgcatctcaacaatctgct |
117 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11417678 |
atacatgtctatctaaggggttagcatcaaacagaaagaagacttgatagaacgatttgcaaccaacttcggatcaactcatgcatctcaacaatccgct |
11417579 |
T |
 |
| Q |
118 |
ctactcttacaagagttcattatccacttcttttagatttttagattagtgaggttagggttacatctaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11417578 |
ctactcttacaagagttcattatccacttcttttagattttcagattagtgaggttagggttacatctaa |
11417509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University