View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21658_low_21 (Length: 239)
Name: NF21658_low_21
Description: NF21658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21658_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 229
Target Start/End: Original strand, 38367546 - 38367764
Alignment:
| Q |
11 |
acatcatctttcaagcctcccaaatacaatgacactctcttcaagcaccacaactatgtggcgaggatccgatgaggacgaatccagcaaccagtttgcc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367546 |
acatcatctttcaagcctcccaaatacaatgacactctcttcaagcaccacgactatgtggcgaggatccgatgaggacgaatccagcaaccagtttgcc |
38367645 |
T |
 |
| Q |
111 |
gaaccaataagatggaagaaattcgcgcatgtgtgcacctcagtggtcaagtatgaccccaactggttgcacgaatcaaattcaagcggggtttatatcg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367646 |
gaaccaataagatggaagaaattcgcgcatgtgtgcacctcagtggtcaagtatgaccccaactggttgcacgaatcaaattcaagcggggtttatatcg |
38367745 |
T |
 |
| Q |
211 |
taaccggtgctcaactcat |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38367746 |
taaccggtgctcaactcat |
38367764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University