View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21659_low_11 (Length: 272)
Name: NF21659_low_11
Description: NF21659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21659_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 256
Target Start/End: Original strand, 30770399 - 30770639
Alignment:
| Q |
16 |
atgctggtagcaggcttcaacaagagaacaaagttgtaatgaagcaagatggtgggtttgttgtttcttctgctaatgtggctatggctgcaattcctgc |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770399 |
atgccggtagcaggcttcaacaagagaacaaagttgtaatgaagcaagatggtgggtttgttgtttcttctgctaatgtggctatggctgcaattcctgc |
30770498 |
T |
|
| Q |
116 |
aacatcaacaatggcttttggtggagttgttgctgctactagtggtgatgttaatgtgaatagggttgtttctgatgatgagagatcagattatggagga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770499 |
aacatcaacaatggcttttggtggagttgttactgctactagtggtgatgttaatgtgaatagggttgtttctgatgatgagagatcagattatggagga |
30770598 |
T |
|
| Q |
216 |
ttaatcggatctcgaaaaccgcctttgccattgcagcttgt |
256 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
30770599 |
ttaatcggatctcgaaaacctcctttaccgttgcagcttgt |
30770639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University