View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21659_low_9 (Length: 300)
Name: NF21659_low_9
Description: NF21659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21659_low_9 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 131 - 300
Target Start/End: Original strand, 36127700 - 36127869
Alignment:
| Q |
131 |
tcgttggagcttttcttgcgtgtggttgtggattttggaggacgagttgactcggtaacgccgctgagttggatgcagtaaggtgatgtggtggtggcca |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127700 |
tcgttggagcttttcttgcgtgtggttgtggattttggaggacgagttgactcggtaacgccgctgagttggatgcagtaaggtgatgtggtggtggcca |
36127799 |
T |
 |
| Q |
231 |
ttgaaattccggagcatttcaaggatgcagataaactgtgcttttaaaaatcggatatatatcttatctg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127800 |
ttgaaattccggagcatttcaaggatgcagataaactgtgcttttaaaaatcggatatatatcttatctg |
36127869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 36127613 - 36127476
Alignment:
| Q |
1 |
aagaagatatccccgctcactaccgcctccgtgttgccggtaagcgcttccaaaaggattggaccgtgtcggaggtcgtcgactccgtcctctccctcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127613 |
aagaagatatccccgctcactaccgcctccgtgttgccggtaaccgcttccaaaaggattggaccgtgtcggaggtcgtcgactccgtcctctccctcac |
36127514 |
T |
 |
| Q |
101 |
tctccgtgacgacattgaaggcctgctcaatcgttgga |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127513 |
tctccgtgacgacattgaaggcctgctcaatcgttgga |
36127476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University