View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21659_low_9 (Length: 300)

Name: NF21659_low_9
Description: NF21659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21659_low_9
NF21659_low_9
[»] chr7 (2 HSPs)
chr7 (131-300)||(36127700-36127869)
chr7 (1-138)||(36127476-36127613)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 131 - 300
Target Start/End: Original strand, 36127700 - 36127869
Alignment:
131 tcgttggagcttttcttgcgtgtggttgtggattttggaggacgagttgactcggtaacgccgctgagttggatgcagtaaggtgatgtggtggtggcca 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36127700 tcgttggagcttttcttgcgtgtggttgtggattttggaggacgagttgactcggtaacgccgctgagttggatgcagtaaggtgatgtggtggtggcca 36127799  T
231 ttgaaattccggagcatttcaaggatgcagataaactgtgcttttaaaaatcggatatatatcttatctg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36127800 ttgaaattccggagcatttcaaggatgcagataaactgtgcttttaaaaatcggatatatatcttatctg 36127869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 36127613 - 36127476
Alignment:
1 aagaagatatccccgctcactaccgcctccgtgttgccggtaagcgcttccaaaaggattggaccgtgtcggaggtcgtcgactccgtcctctccctcac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36127613 aagaagatatccccgctcactaccgcctccgtgttgccggtaaccgcttccaaaaggattggaccgtgtcggaggtcgtcgactccgtcctctccctcac 36127514  T
101 tctccgtgacgacattgaaggcctgctcaatcgttgga 138  Q
    ||||||||||||||||||||||||||||||||||||||    
36127513 tctccgtgacgacattgaaggcctgctcaatcgttgga 36127476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University