View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2165_high_10 (Length: 246)
Name: NF2165_high_10
Description: NF2165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2165_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 228
Target Start/End: Original strand, 7664944 - 7665167
Alignment:
| Q |
5 |
aagccatcaaccttttagatcgtaaatgctttggaggtaatttggcctcaaaagttgatattaaaaaggcttttgacactttagattgaaattttcttcg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7664944 |
aagccatcaaccttttagatcgtaaatgctttggaggtaatttggcctcaaaagttgatattaaaaaggcttttgacactttagattgaaattttcttcg |
7665043 |
T |
|
| Q |
105 |
tcttgtgcttcaacagtttggacttcatttgaggtttattaattggattatggaaattcttcactctgcccgtatatctattttggtgaatggcaaagcc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665044 |
tcttgtgcttcaacagtttggacttcatttgaggtttattaattggattatggaaattcttcactctgcccgtatatctattttggtgaatggcaaagcc |
7665143 |
T |
|
| Q |
205 |
atttgttttttccttgctcccatg |
228 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7665144 |
atttgttttttccttgctcccatg |
7665167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University