View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2165_low_14 (Length: 238)

Name: NF2165_low_14
Description: NF2165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2165_low_14
NF2165_low_14
[»] chr7 (1 HSPs)
chr7 (18-238)||(44694005-44694225)


Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 44694225 - 44694005
Alignment:
18 aattgtttctggcggagctacctatgaatctggaaaacatggaggacttgtttgatcgcctcactgtggttacgtgagattgatgcacgtgaacgtgatc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44694225 aattgtttctggcggagctacctatgaatctggaaaacatggaggacttgtttgatcgcctcactgtggttacgtgagattgatgcacgtgaacgtgatc 44694126  T
118 attggcacgtgaagtagtagtggttgcagtaatagaagtgattaaaggaactataccaggaatcccactttgtaataaacacaaagtatccattgttttt 217  Q
    ||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
44694125 attggcacgtgaagtagtagtagttgcactaatagaagtgattaaaggaactataccaggaatcccactttgtaataaacacaaagtaaccattgttttt 44694026  T
218 aaagattatatgaatatggtt 238  Q
    ||||||| |||||||||||||    
44694025 aaagattgtatgaatatggtt 44694005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University