View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2165_low_8 (Length: 339)
Name: NF2165_low_8
Description: NF2165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2165_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 236
Target Start/End: Complemental strand, 28216813 - 28216588
Alignment:
| Q |
12 |
tgagaagaaatatgagcattattgaatcgaacacgatttctagctatccaaatagtgtgaataat-ctaacaatgatgatatcgagacattgcgagctgc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28216813 |
tgagaagaaatatgagcattattgaatcgaacacgatttctagctatccaaatagtgtgaataatactaacaatgatgatatcgagacattgcgagctgc |
28216714 |
T |
|
| Q |
111 |
agtgattgggaatgtaacatgcctcccaaccaagacaataaattgagactacagtgcagcctctcaaccataaaatgagcataaatattaaatagggtta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28216713 |
agtgattgggaatgtaacatgcctcccaaccaagacaataaattgagaccacagtgcagcctctcaaccgtaaaatgagcataaatattaaatagggtta |
28216614 |
T |
|
| Q |
211 |
ttgaatctagtacatatcttgatttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28216613 |
ttgaatctagtacatatcttgatttc |
28216588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University