View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21660_high_26 (Length: 362)
Name: NF21660_high_26
Description: NF21660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21660_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 345
Target Start/End: Complemental strand, 1748677 - 1748333
Alignment:
| Q |
1 |
cgacttcataagaaatgaaagagcatcagatcttgctggtgtatcttcaacaaatgctcttacttttataggtaaaaaccaaatcctaccaattttattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1748677 |
cgacttcataagaaatgaaagagcatcagatcttgctggtgtatcttcaacaaatgctcttacttttataggtaaaaaccaaatcctaccaattttattg |
1748578 |
T |
 |
| Q |
101 |
gtatatatatgtgtgcggagatagggatgaaatgtgatttaatacatatatgaaatatggcaaatgctaactaactcatgcatagtatatattggggata |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1748577 |
gtatatatatgtgtgtggagatagggatgaaatgtgatttaatacatatatgaaatatggcaaatgctaactaactcatgcatagtatatattggggata |
1748478 |
T |
 |
| Q |
201 |
actatatgtttttgatatgnnnnnnnnnnnngtaggggaatggacgggtgagtggaccatacaaaatgcgtctaagcaagatttccaaaacttcgcccaa |
300 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1748477 |
actatatgtttttgatatgttttttctttttgtaggggaatggacgggtgagtggaccatacaaaatgcgtctaagcaagatttccaaaacttcgcccaa |
1748378 |
T |
 |
| Q |
301 |
gcccaattggatgtgtattctcggacaacatttggatgggcttat |
345 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1748377 |
gcccaattggatgtgtattctcgggcaacatttggatgggcttat |
1748333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 87
Target Start/End: Complemental strand, 1717324 - 1717239
Alignment:
| Q |
2 |
gacttcataagaaatgaaagagcatcagatcttgctggtgtatcttcaacaaatgctcttacttttataggtaaaaaccaaatcct |
87 |
Q |
| |
|
|||| |||||||||||| ||||| | |||||| |||||| |||||| |||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
1717324 |
gactacataagaaatgatagagcctgggatcttagtggtgtctcttcatcaaatgctcttagttttgtaggtaaataccaaatcct |
1717239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 232 - 343
Target Start/End: Complemental strand, 1738556 - 1738445
Alignment:
| Q |
232 |
gtaggggaatggacgggtgagtggaccatacaaaatgcgtctaagcaagatttccaaaacttcgcccaagcccaattggatgtgtattctcggacaacat |
331 |
Q |
| |
|
|||||||||||||||| ||| |||| ||||||| |||||||| |||||| | ||||| | | |||| | ||| ||||||| |||||||| |||||| |
|
|
| T |
1738556 |
gtaggggaatggacggctgaatggagcatacaaggtgcgtctatgcaagactaccaaagatatgtccaaacacaaatggatgtatattctcgtgcaacat |
1738457 |
T |
 |
| Q |
332 |
ttggatgggctt |
343 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1738456 |
ttggatgggctt |
1738445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 297 - 345
Target Start/End: Complemental strand, 1753637 - 1753589
Alignment:
| Q |
297 |
ccaagcccaattggatgtgtattctcggacaacatttggatgggcttat |
345 |
Q |
| |
|
|||||| ||| | |||||||||||||| |||||||||||||||||||| |
|
|
| T |
1753637 |
ccaagcacaactagatgtgtattctcgtgcaacatttggatgggcttat |
1753589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University