View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21660_low_27 (Length: 318)
Name: NF21660_low_27
Description: NF21660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21660_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 24 - 229
Target Start/End: Complemental strand, 27781851 - 27781648
Alignment:
| Q |
24 |
agtctacatcaaggactagcgatgatggtttaattttcctttcttcttctccattcactttagttttgccgtcttgaaagccagggataccataccagaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27781851 |
agtctacatcaaggactagcgatgatggtttaattttcctttcttcttctccattcactttagttttgccgtcttgaaagccagggataccataccagaa |
27781752 |
T |
 |
| Q |
124 |
agttattttgatgcacagatgaattttgatatatgataatacatggtgattttacaaattaattaatgattgtactaatcattccttttagttactgcca |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
27781751 |
agttattttgatg--cagatgaattttgatatatggtaatacatggtgattttacaaattaattaatcatcgtactaatcattccttttagttactgcca |
27781654 |
T |
 |
| Q |
224 |
ctacta |
229 |
Q |
| |
|
|||||| |
|
|
| T |
27781653 |
ctacta |
27781648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 272
Target Start/End: Original strand, 24414402 - 24414446
Alignment:
| Q |
228 |
tattagtcatcaaaatcgcttaacagatcacaaagcggaaagtat |
272 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
24414402 |
tattagtcatcaaaaccacttaacagatcacaaaggggaaagtat |
24414446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University