View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21660_low_31 (Length: 301)
Name: NF21660_low_31
Description: NF21660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21660_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 138 - 283
Target Start/End: Original strand, 39927944 - 39928089
Alignment:
| Q |
138 |
gattaatttttattgtcaaattttgtttatatttttaaacggatgaaatcatttgttggtatctcatagaatcagcggtccaagtcatcctatttatgct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39927944 |
gattaatttttattgtcaaattttgtttatattttaaaacggattaaatcatttgttggtatctcatagaatcagcggtccaagtcatcctatttatgct |
39928043 |
T |
|
| Q |
238 |
atgagttgcttccttttacctaaaggaatatgtgtgatcaacttgc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39928044 |
atgagttgcttccttttacctaaaggaatatgtgtgatcaacttgc |
39928089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 14 - 76
Target Start/End: Original strand, 39927817 - 39927879
Alignment:
| Q |
14 |
gagagggagagatcatactagtgcggcagatctagaagcaagtgtttaattcgtcggtccgtc |
76 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39927817 |
gagagggagggatcatactagtgcggaagatctagaagcaagtgtttaattcgtccgtccgtc |
39927879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University