View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21660_low_33 (Length: 260)
Name: NF21660_low_33
Description: NF21660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21660_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 23 - 215
Target Start/End: Complemental strand, 4388563 - 4388372
Alignment:
| Q |
23 |
aagtaaagatgttttcaatgatatgaaaacatgttaatgaaagaagaccaannnnnnnnnnnnnnnnnnnctaaatgcctaaataagtcttatttttatt |
122 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4388563 |
aagtaaagatgtttttaatgatatgaaaacatgtgaatgaaagaagaccaa-ttttttttctttctttttctaaatgcctaaataagtcttatttttatt |
4388465 |
T |
|
| Q |
123 |
aagattcatttaaatatttacttttcctaaacaagtaacatactaacagtagaaatatgggtcagattttgctaagctttgcgtaaagaggtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4388464 |
aagattcatttaaatatttacttttcctaaacaagtaacatattaagagtagaaatatgggtcagattttgctaagctttgcgtaaataggtg |
4388372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University