View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21660_low_38 (Length: 233)
Name: NF21660_low_38
Description: NF21660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21660_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 5982413 - 5982613
Alignment:
| Q |
17 |
accatcaaaaagaacagaattgcaataatgtctgtaattagtatttgtcgtccatgaggtgtcaactcagtggtaatggtaagagtttgaccttgtaacc |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982413 |
accatcaaaaagaagagaattgcaataatgtctgtaattagtatttgtcatccatgaggtgtcaactcagtggtaatggtaagagtttgaccttgtaacc |
5982512 |
T |
|
| Q |
117 |
tatgaaagatatttgtaaaatgatcattaatatcactttaataaatgattattgaaacatatttgtctccatctttctcttgcttcaaattatcatgcct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982513 |
gatgaaagatatttgtaaaatgatcattaatatcactttaataaatgattattgaaacata--tgtctccatctttctcttgcttcaaattatcatgcct |
5982610 |
T |
|
| Q |
217 |
ttg |
219 |
Q |
| |
|
||| |
|
|
| T |
5982611 |
ttg |
5982613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University