View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21660_low_40 (Length: 226)
Name: NF21660_low_40
Description: NF21660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21660_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 20132994 - 20132787
Alignment:
| Q |
1 |
acttaacttttaaggcttagaatgatcgcacttctcgctctgtcacagatagagccctgatgatgtagtatacaaaattatacgttannnnnnnnaaa-- |
98 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
20132994 |
acttaacttttaaggtttaggatgatcgcacttctcgctctgccacagatacagccctgatgatgtggtatacaaaattatacgttattttttttaaaga |
20132895 |
T |
 |
| Q |
99 |
acagaactatatgctaatatcagtcatgatatattatggcaaaaggaaaactatgatgtaaaacaaaccaagtatttcaatttaggatagatcaaattac |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20132894 |
acaaaactatatgctaatatcagtcatgatatattatggcaaaaggaaaactatgatgtaaaacaaaccaagtatttcaaattaggatagatcaaattac |
20132795 |
T |
 |
| Q |
199 |
gctaatac |
206 |
Q |
| |
|
|||||||| |
|
|
| T |
20132794 |
gctaatac |
20132787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University