View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21661_high_13 (Length: 307)
Name: NF21661_high_13
Description: NF21661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21661_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-144; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 19 - 296
Target Start/End: Complemental strand, 4597381 - 4597104
Alignment:
| Q |
19 |
cattgtagtggaatcttatttactttattaatgcatcaacatagttatatgatctaagaccctcttccatttctttcacttgaactgaacccaccaagtc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4597381 |
cattgtagtggaatcttatttactttattaatgcatcaacatagttatatgatctaagaccctcttccatttctttcacctgaactgaacccaccaagtc |
4597282 |
T |
|
| Q |
119 |
caaccatacaattgtatgatcaaacatgactaagaggccacaaatatatcttttcggtgactcaatcactgaggaatcctttgatgttggaggatggggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4597281 |
caaccatacaattgtatgatcaaacatgactaagaggccacaaatatatctttttggtgactcaatcactgaggaatcctttgatgttggaggatggggt |
4597182 |
T |
|
| Q |
219 |
gcttctcttgccaactttttctcacgcacggtaacatccattcttgctttcttttgctttaacaactcatattttcat |
296 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4597181 |
gcttctctttccaactttttctcacgcacagtaacatccattcttgctttgttttgctttaacaactcatattttcat |
4597104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 180 - 252
Target Start/End: Complemental strand, 4587651 - 4587579
Alignment:
| Q |
180 |
tcaatcactgaggaatcctttgatgttggaggatggggtgcttctcttgccaactttttctcacgcacggtaa |
252 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||| ||||||||| |||||| || ||||||| |
|
|
| T |
4587651 |
tcaatcactgaagaatcctttggtgttggaggatggggtgcttcttttgccaactatttctctcgtacggtaa |
4587579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 251
Target Start/End: Complemental strand, 4602206 - 4602122
Alignment:
| Q |
167 |
tcttttcggtgactcaatcactgaggaatcctttgatgttggaggatggggtgcttctcttgccaactttttctcacgcacggta |
251 |
Q |
| |
|
|||||||||||| ||||||||||| || || || ||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
4602206 |
tcttttcggtgattcaatcactgaagattcattctctgttggaggatggggtgcttctcttgccaaccatttctctcgcacggta |
4602122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University