View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21661_high_16 (Length: 289)
Name: NF21661_high_16
Description: NF21661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21661_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 152 - 271
Target Start/End: Complemental strand, 49932271 - 49932153
Alignment:
| Q |
152 |
aaataaaaatagagtaatatagatccttaaatatgaagattgagtgaatcttttcaagaattgattgaataagcgagagcctttcggcttccaaaaattg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49932271 |
aaataaaaatagagtaatatagatccttaaatttaaagattgagcgaatcttttcaagaattgattgaataa-cgagagcctttcggcttccaaaaattg |
49932173 |
T |
 |
| Q |
252 |
acgaaatgtcatccgaaacc |
271 |
Q |
| |
|
|||| ||| | ||||||||| |
|
|
| T |
49932172 |
acgagatgccgtccgaaacc |
49932153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 41 - 88
Target Start/End: Complemental strand, 49932660 - 49932613
Alignment:
| Q |
41 |
atgtggatgcagagaggaaacatgagatcggattgagtgtggaaatga |
88 |
Q |
| |
|
||||||||||||||| ||||| |||||| | ||||||||||||||||| |
|
|
| T |
49932660 |
atgtggatgcagagacgaaacttgagattgaattgagtgtggaaatga |
49932613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 93
Target Start/End: Original strand, 27345837 - 27345878
Alignment:
| Q |
52 |
gagaggaaacatgagatcggattgagtgtggaaatgactaat |
93 |
Q |
| |
|
||||||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
27345837 |
gagaggagacatgagatcagattgagtgtggcaatgactaat |
27345878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University