View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21661_low_16 (Length: 289)

Name: NF21661_low_16
Description: NF21661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21661_low_16
NF21661_low_16
[»] chr4 (2 HSPs)
chr4 (152-271)||(49932153-49932271)
chr4 (41-88)||(49932613-49932660)
[»] chr5 (1 HSPs)
chr5 (52-93)||(27345837-27345878)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 152 - 271
Target Start/End: Complemental strand, 49932271 - 49932153
Alignment:
152 aaataaaaatagagtaatatagatccttaaatatgaagattgagtgaatcttttcaagaattgattgaataagcgagagcctttcggcttccaaaaattg 251  Q
    |||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
49932271 aaataaaaatagagtaatatagatccttaaatttaaagattgagcgaatcttttcaagaattgattgaataa-cgagagcctttcggcttccaaaaattg 49932173  T
252 acgaaatgtcatccgaaacc 271  Q
    |||| ||| | |||||||||    
49932172 acgagatgccgtccgaaacc 49932153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 41 - 88
Target Start/End: Complemental strand, 49932660 - 49932613
Alignment:
41 atgtggatgcagagaggaaacatgagatcggattgagtgtggaaatga 88  Q
    ||||||||||||||| ||||| |||||| | |||||||||||||||||    
49932660 atgtggatgcagagacgaaacttgagattgaattgagtgtggaaatga 49932613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 93
Target Start/End: Original strand, 27345837 - 27345878
Alignment:
52 gagaggaaacatgagatcggattgagtgtggaaatgactaat 93  Q
    ||||||| |||||||||| |||||||||||| ||||||||||    
27345837 gagaggagacatgagatcagattgagtgtggcaatgactaat 27345878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University