View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21661_low_18 (Length: 263)
Name: NF21661_low_18
Description: NF21661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21661_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 22 - 246
Target Start/End: Complemental strand, 12365881 - 12365657
Alignment:
| Q |
22 |
gtttggatcagacgaagagtagtagcagttctctaagaagtagctcctagactggcgtgactcatactgccagctgtcccctattagttactttacggtc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||| |||| |
|
|
| T |
12365881 |
gtttggatcagacgaagagtagtagcagtcctctgagaagtagctcctagactggcatgactcatactgccagctgtccgctattagttgctttatggtc |
12365782 |
T |
 |
| Q |
122 |
tcttcatcaagattctcggaaggctcaatatccattagattttcttcaaaattcatttgtgtgaactattgttcaatattttcctaaaattcttgttctg |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||| |
|
|
| T |
12365781 |
tcttcatcaagattctctaaaggctcaatatccgttggattttcttcaaaattcatttgtgtgaactgttgttcaatattttcctgaaagtcttgttctg |
12365682 |
T |
 |
| Q |
222 |
gttgagatgcctatctggagctttc |
246 |
Q |
| |
|
|||||||||||| ||| |||||||| |
|
|
| T |
12365681 |
gttgagatgcctgtctagagctttc |
12365657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 200
Target Start/End: Complemental strand, 657544 - 657492
Alignment:
| Q |
148 |
aatatccattagattttcttcaaaattcatttgtgtgaactattgttcaatat |
200 |
Q |
| |
|
||||| |||| ||||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
657544 |
aatattcattggattttcttcaaaattcattttcgtgaattgttgttcaatat |
657492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University