View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21661_low_22 (Length: 208)
Name: NF21661_low_22
Description: NF21661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21661_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 14 - 172
Target Start/End: Complemental strand, 39059828 - 39059670
Alignment:
| Q |
14 |
caaagggaattgaaggaaaggagggatgtgcatatcgatagaagggttatacttttcgatgattaagtagagtaactaggtagaaaaatgttgtgtttta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39059828 |
caaagggaattgaaggaaaggagggatgtgcatatcgatagaagggttatacttttcgatgattaagtagagtaactaggtagaaaaatgttgtgtttta |
39059729 |
T |
|
| Q |
114 |
gctaacatcgatctactaaattgaagtatggagaactaaagtctttcgagcaaaagaat |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39059728 |
gctaacatcgatctactaaattgaagtatggagaactaaagtctttcgagcaaaagaat |
39059670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 66 - 111
Target Start/End: Original strand, 15174779 - 15174824
Alignment:
| Q |
66 |
ttttcgatgattaagtagagtaactaggtagaaaaatgttgtgttt |
111 |
Q |
| |
|
||||| |||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
15174779 |
ttttcaatgattaagtagagaaattaggtagaaaaaggttgtgttt |
15174824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 76 - 117
Target Start/End: Complemental strand, 16380818 - 16380777
Alignment:
| Q |
76 |
ttaagtagagtaactaggtagaaaaatgttgtgttttagcta |
117 |
Q |
| |
|
||||||||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
16380818 |
ttaagtagattaagtaggtagaaaaaggttgtgttttagcta |
16380777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University