View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21662_high_19 (Length: 315)
Name: NF21662_high_19
Description: NF21662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21662_high_19 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 156 - 315
Target Start/End: Complemental strand, 2391173 - 2391019
Alignment:
| Q |
156 |
caccattttatcctcaatattttgttcttgactcttgagttgtaactatcaactttatttcttcccttttcaataagattttccatatttgtttctgtta |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2391173 |
caccattttatcctcaatattttgttcttgactcttgagttgtaactatctactttatttcttcccttttcaataagattttccatatttgtttctgtta |
2391074 |
T |
|
| Q |
256 |
ctgatacagataataactgaattattaggcctaacctaacggtgccaaaaatatataact |
315 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2391073 |
ctgttacagataataactgaattattaggcc-----taacggtgccaaaaatatataact |
2391019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 3 - 149
Target Start/End: Original strand, 2391307 - 2391458
Alignment:
| Q |
3 |
actaagcggcaaaggatttatggtatgtgttaaatttgaattgaatggtttggactttcaaca-----tgtggaatttaatatgaaaattgttactttgg |
97 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2391307 |
actaagcggcaaaggatttatggtatgcgttaaatttgaattgaatggtttggactttcaacgcatattgtggaatttaatatgaaaattgttactttgg |
2391406 |
T |
|
| Q |
98 |
tcnnnnnnntaatatgaacatgtgactcagcaagcaagcaataccagaataa |
149 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2391407 |
tcaaaaaaataatatgaacatgtgactcagcaagcaagcaataccagaataa |
2391458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University