View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21662_high_23 (Length: 280)
Name: NF21662_high_23
Description: NF21662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21662_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 18 - 272
Target Start/End: Complemental strand, 44495360 - 44495106
Alignment:
| Q |
18 |
gagaacggcagcttgtttctatgatcaccttgtaattgcaggtgcctgtcggtctagtcattttatcctgattatcctgaaacatgcatatacaataaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44495360 |
gagaacggcagcttgtttctatgatcaccttgtaattgcaggtgcctgtcggtctagtcattttatcctgattatcctgaaacatgcatatacaataaca |
44495261 |
T |
 |
| Q |
118 |
tataaccttttatttaaaatgcaaaaatatatgaaatttggatacataaagcatttttatttacattttcctgggcatagtatagtatgggagattgatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44495260 |
tataaccttttatttaaaatgcaaaaatatatgaaatttggatacataaagcatttttatttacattttcctgggcatagtatagtatgggagattgatt |
44495161 |
T |
 |
| Q |
218 |
tatttgaggttgagtgaccaatgttggtgttgcatgtgagaaggcagtgatgatg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44495160 |
tatttgaggttgagtgaccaatgttggtgttgcatgtgagaaggcagtgatgatg |
44495106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 229 - 263
Target Start/End: Complemental strand, 44488858 - 44488824
Alignment:
| Q |
229 |
gagtgaccaatgttggtgttgcatgtgagaaggca |
263 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
44488858 |
gagtgaccaatgttggtgctgcatgtgagaaggca |
44488824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University