View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21662_low_21 (Length: 297)
Name: NF21662_low_21
Description: NF21662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21662_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 13 - 283
Target Start/End: Original strand, 8752825 - 8753095
Alignment:
| Q |
13 |
tgagatgagaaccaaattcatttaccattgtatcggagccgagttaattattgcaatgtgagaaattgacccacaaataagctagatgtgagtatgaata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||| || |||||||| ||||||||||||| |
|
|
| T |
8752825 |
tgagatgagaaccaaattcatttaccattgtatcggagccgaattaatgattgcaatgtgagaatttgacccacgaacaagctagacgtgagtatgaata |
8752924 |
T |
 |
| Q |
113 |
ttaaaaattatccgttgtttatttgaagtctcacattattccgatttccggaatgttgagtgtaatccctatataaatcaattaagtcatagtcagttta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8752925 |
ttaaaaattatccgttgtttatttgaagtctcacattattccaatttccggaatgttgagtgtaatccctatataaatcaattaagtcatagtcagttta |
8753024 |
T |
 |
| Q |
213 |
taccaagggaaaatcaaatgcaacctaagttttgtacttgtatgttaatttgatttactcgaggatgattt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8753025 |
taccaagggaaaatcaaatgcaacctaagttttgtacttgtatgttaatttgatttacccgaggatgattt |
8753095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University