View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21662_low_31 (Length: 246)

Name: NF21662_low_31
Description: NF21662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21662_low_31
NF21662_low_31
[»] chr5 (3 HSPs)
chr5 (23-110)||(34332511-34332598)
chr5 (182-246)||(34331983-34332047)
chr5 (138-186)||(34332176-34332224)


Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 23 - 110
Target Start/End: Complemental strand, 34332598 - 34332511
Alignment:
23 ataaactttaatgtcatattataatttgggtttaagccaattactctttcttttttacttaacctaaatgaaggttaaaaactactac 110  Q
    |||||||||||| |||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| ||  ||||||||||||||    
34332598 ataaactttaatatcatattataatttcggtttatgcctattactctttcttttttacttaacctaaatcaatcttaaaaactactac 34332511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 182 - 246
Target Start/End: Complemental strand, 34332047 - 34331983
Alignment:
182 tttcacacaaaaaaggcatgatcatttgaggatgtgaccgtacataggactcggggtccatacaa 246  Q
    |||| |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||    
34332047 tttcccacaaaaaaggcatgatcatttggagatgtgaccgtacataggactcggggtccatacaa 34331983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 186
Target Start/End: Complemental strand, 34332224 - 34332176
Alignment:
138 ataaggaatatctcctacacatttaaaattatttataaataaattttca 186  Q
    |||| ||||||||| | |||||||||||||||||||||||| |||||||    
34332224 ataatgaatatctcatgcacatttaaaattatttataaatacattttca 34332176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University