View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21662_low_31 (Length: 246)
Name: NF21662_low_31
Description: NF21662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21662_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 23 - 110
Target Start/End: Complemental strand, 34332598 - 34332511
Alignment:
| Q |
23 |
ataaactttaatgtcatattataatttgggtttaagccaattactctttcttttttacttaacctaaatgaaggttaaaaactactac |
110 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
34332598 |
ataaactttaatatcatattataatttcggtttatgcctattactctttcttttttacttaacctaaatcaatcttaaaaactactac |
34332511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 182 - 246
Target Start/End: Complemental strand, 34332047 - 34331983
Alignment:
| Q |
182 |
tttcacacaaaaaaggcatgatcatttgaggatgtgaccgtacataggactcggggtccatacaa |
246 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34332047 |
tttcccacaaaaaaggcatgatcatttggagatgtgaccgtacataggactcggggtccatacaa |
34331983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 186
Target Start/End: Complemental strand, 34332224 - 34332176
Alignment:
| Q |
138 |
ataaggaatatctcctacacatttaaaattatttataaataaattttca |
186 |
Q |
| |
|
|||| ||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
34332224 |
ataatgaatatctcatgcacatttaaaattatttataaatacattttca |
34332176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University