View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21663_high_4 (Length: 270)
Name: NF21663_high_4
Description: NF21663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21663_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 2 - 256
Target Start/End: Original strand, 42717070 - 42717330
Alignment:
| Q |
2 |
tcttctctacttgcatttttcaatttctcttgtttaatttcgtttctgaaactctcttccacaatgccgattaatttgaatttctttccaattttggata |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42717070 |
tcttctgtacttgcatttttcaatttctcttgtttaatttcgtttctgaaactctcttccacaatgccgattaatttgaatttctttccaattttggata |
42717169 |
T |
 |
| Q |
102 |
cctttgcaattttctgatttgttctatgagattgacgcggatgtggataatg------nnnnnnntaaatttgatagctgaatttcactccatgttattg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
42717170 |
cctttgcaattttctgatttgttctatgagattgacgcggatgtggataatgaaaataaaaataaaaaaattgatagctgaatttcactccatgttattg |
42717269 |
T |
 |
| Q |
196 |
gcgtttatgattggaaacaaataaatgctattgagttcgaagtgctttttgtggatatttt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42717270 |
gcgtttatgattggaaacaaataaatgctattgagttcgaagtgctttttgtggatatttt |
42717330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University