View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21663_low_5 (Length: 239)
Name: NF21663_low_5
Description: NF21663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21663_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 21 - 121
Target Start/End: Complemental strand, 42716902 - 42716802
Alignment:
| Q |
21 |
ggcgaggagagagaaagagaatgaaggataacaaagaagtagatggcagagaatgaggactttgagaatcgcatgtgatgataacctcatctctctggtt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42716902 |
ggcgaggagagagaaagagaatgaaggataacaaagaagtagatggcagagaatgaggactttgagaatcgcatgtgatgataacctcatctctctggtt |
42716803 |
T |
 |
| Q |
121 |
t |
121 |
Q |
| |
|
| |
|
|
| T |
42716802 |
t |
42716802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 157 - 233
Target Start/End: Complemental strand, 42716764 - 42716688
Alignment:
| Q |
157 |
ttttacagcgacaccgttagagtaatggcgcgcgaaatctctctcaccgttgcaaacgcagagagatgaagagagag |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42716764 |
ttttacagcgacaccgttagagtaatggcgcgcgaaatctctctcaccgttgcaaacgcagagagatgaagagagag |
42716688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University