View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21665_high_8 (Length: 335)
Name: NF21665_high_8
Description: NF21665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21665_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 26 - 312
Target Start/End: Original strand, 46836676 - 46836962
Alignment:
| Q |
26 |
atcaataaattcttgattatcaaccatacaaggtatgtcactagttgtcattcagcagcagaatattctgcatacaaagtcctttctaagtgtcagatta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46836676 |
atcaataaattcttgattatcaaccatacaaggtatgtcactagttgtcattcagcagcagaatattctgcatacaaagtcctttctaagtgtcagatta |
46836775 |
T |
 |
| Q |
126 |
gatctgtacttaaacaaacaacctcagtctagaatttccaatctagttttcagcttggtttctaaccacagtcatagaaaactatatcttggtgggacaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46836776 |
gatctgtacttaaacaaacaacctcagtctagaatttccaatctagttttcagcttggtttctaaccacagtcatagaaaactatatcttggtgggacaa |
46836875 |
T |
 |
| Q |
226 |
aaatgatacctattaataaaatcaggcacagtttctatcccgttgaatgtcaacaaggcttgcctgatgaagatgaagatgatgatg |
312 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46836876 |
aaatggtacctattaataaaatcaggcacagtttctatcccgttgaatgtcaacaaggcttgcctgatgaagatgaagatgatgatg |
46836962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University