View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21666_high_4 (Length: 338)
Name: NF21666_high_4
Description: NF21666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21666_high_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 28941812 - 28941475
Alignment:
| Q |
1 |
catattagataagatagcaaacccaaaactgtttcttgacaagcaaaccaaacatgaaattaaactcaggatgtcaaattcacttagaaaaattgaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28941812 |
catattagataagatagcaaacccaaaactgtttcttgacaagcaaaccaaacatgaaattaaactcaggatgtcaaattcacttagaaaaattgaaaca |
28941713 |
T |
 |
| Q |
101 |
tttttgtgatgatttctttcctataggtactaacatacataattttgagcgctggagcttcatccatggaggtggtgtacctagctgagaatggagacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28941712 |
tttttgtgatgatttctttcctataggtactaacatacataattttgagcgctggagcttcatccatggaggtggtgtacctagctgagaatggagacag |
28941613 |
T |
 |
| Q |
201 |
tgcaacagtatggaactcagcttgtggctcttttggtcaattttgtcacaaggtcacagcttcagtagctatcacatttgtagcacttttttgctatgtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28941612 |
tgcaacagtatggaactcagcttgtggctcttttggtcaattttgtcacaaggtcacagcttcagtagctatcacatttgtagcacttttttgctatgtg |
28941513 |
T |
 |
| Q |
301 |
attctttccctcatttcctcttacaagctattcagcaa |
338 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28941512 |
attctttccctcatttcctctttcaagctattcagcaa |
28941475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 217 - 279
Target Start/End: Complemental strand, 32630335 - 32630273
Alignment:
| Q |
217 |
tcagcttgtggctcttttggtcaattttgtcacaaggtcacagcttcagtagctatcacattt |
279 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| ||| ||||||| ||| |||||||||| |
|
|
| T |
32630335 |
tcagcttgtgggtcttttggttcattttgtcacaagatcaaagcttcattagttatcacattt |
32630273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University