View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21667_high_4 (Length: 515)
Name: NF21667_high_4
Description: NF21667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21667_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 269 - 494
Target Start/End: Complemental strand, 4201153 - 4200928
Alignment:
| Q |
269 |
tagggtttagttcatattcaattttgttcaattcaattgaattcgattttcaatgatgatggaaggagcaagcaatggaggaatgttgtatcacgaggta |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4201153 |
tagggtttagttcatattcaattttgttcaattcaattgaattcgattttcaatgatgatggaaggagcaagcaatggaggaatgttgtatcacgaggta |
4201054 |
T |
|
| Q |
369 |
caagaatcgaagctttgcgctgttcattgcgtcaacactgttcttcaaggtccgtttttctctgaattcgacttggctgctcttgcttctgatctcgatt |
468 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4201053 |
caagaatcgaagctttgcgctgttcattgcgtcaacactgttcttcaaggtccgtttttctctgaatttgacttggctgctcttgcttctgatctcgatt |
4200954 |
T |
|
| Q |
469 |
gcaaagagaggcagatgatgatgatg |
494 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4200953 |
gcaaagagaggcagatgatgatgatg |
4200928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 4201258 - 4201211
Alignment:
| Q |
165 |
gacctcttttaatttccaaatcttcttcc-tttctcgtcttctgcaac |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4201258 |
gacctcttttaatttccaaatcttcttccttttctcgtcttctgcaac |
4201211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University