View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21668_high_5 (Length: 441)
Name: NF21668_high_5
Description: NF21668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21668_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 9 - 410
Target Start/End: Original strand, 56416500 - 56416903
Alignment:
| Q |
9 |
gacatcatcgcctgccggggaatgcaactagtgatatggtgatttcaaaactcattgatacaagggtctggaaaactagtagtcatttcttgtacaggat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56416500 |
gacatcatcgcctgccggggaatgcaactagtgatatggtgatttcaaaactcattgatacaagggtctggaaaactagtagtcatttcttgtacaggat |
56416599 |
T |
|
| Q |
109 |
gaaagattttgcttttttgttgtatttgtatatcttttagctacatcatctgatgatcaattgctgccccctaacatcctcgtagaaatattgaatgctg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
56416600 |
gaaagattttgcttttttgttgtatttgtatatcttttagctacatcatctgatgatcaattgctgccccctaacatcctcgtagaaaaattgaatgctg |
56416699 |
T |
|
| Q |
209 |
aaaaaagaaattaatagacattgatggaatccccgagatatttttccgtaaaacttttcatcttctcgaatcattca---ttgtttcccatacatattac |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
56416700 |
aaaaaagaaattaatagacattgatggaatccccgagatatttttccgtaaaacttttcatcttctcgaatcattcattgttgtttcccatacatattac |
56416799 |
T |
|
| Q |
306 |
ggtttactgtcattttctttccccctttttatagtttactgatagggnnnnnnnncccgttgaatagatataggatggggaatgctacaatacaaccgtc |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
56416800 |
ggtttactgtcattttctttccccctttttatagtttactgataggg-tttttttcccgttgaatagatatagggtggggaatgctacaatacaaccgtc |
56416898 |
T |
|
| Q |
406 |
accgt |
410 |
Q |
| |
|
||||| |
|
|
| T |
56416899 |
accgt |
56416903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University