View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21669_high_11 (Length: 358)
Name: NF21669_high_11
Description: NF21669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21669_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 21 - 315
Target Start/End: Complemental strand, 32386834 - 32386540
Alignment:
| Q |
21 |
catcatcactgtgcatgataaccaagtggaagtacccatctttcattctgccacataaattcacaaaagattctatttttagcaatagtaacgtttttcc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32386834 |
catcatcactgtgcatgataaccaagtggaagtacccatctttcattctgccacatagattcacaaaagattctatttttagcaatagtaacgtttttct |
32386735 |
T |
|
| Q |
121 |
gtttctggggtgtgaagagttcactccagtcgtcatttttgattacccaatggagaaaaaattgatctttttggtgacccttttgggatttctcttctat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32386734 |
gtttctggggtgtgaagagttcactccactcgtcatttttcatcacccaatggagaaaaaattgatctttgtggtgacccttttgggatttctcttctat |
32386635 |
T |
|
| Q |
221 |
ggaggagaatccaagtttatagagtataacacctcacagggtgtagtcactgggaagctcaatgttcatctggttgctcatactcatgatgatgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32386634 |
ggaggagaatccaagtttatagagtataacacctcacagggtgtagtctctgggaagctcaatgttcatctggttgctcatactcatgatgatgt |
32386540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University