View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21672_high_21 (Length: 354)
Name: NF21672_high_21
Description: NF21672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21672_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 9e-24; HSPs: 10)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 35074065 - 35073965
Alignment:
| Q |
1 |
gaaacaggtacgataagctgcttttctcaagtatctc-tatatctcttctactctccaagcgatacttatttatgtttgtaaaa-tcatgtgattttcat |
98 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| | || |||||||| ||||| ||||||||| |
|
|
| T |
35074065 |
gaaacaggtacaataagctgcttttctcaagtatctcttatctctcttctactctccaagcgatacttaatcatcattgtaaaattcatgcgattttcat |
35073966 |
T |
 |
| Q |
99 |
c |
99 |
Q |
| |
|
| |
|
|
| T |
35073965 |
c |
35073965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 35100800 - 35100732
Alignment:
| Q |
1 |
gaaacaggtacgataagctgcttttctcaagtatctc-tatatctcttctactctccaagcgatactta |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
35100800 |
gaaacaggtacgataagctgcttttctcaagtatctcttatctctcttctactctccaagcgatactta |
35100732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 35085512 - 35085466
Alignment:
| Q |
1 |
gaaacaggtacgataagctgcttttctcaagtatctctatatctctt |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35085512 |
gaaacaggtacgataagctgcttttctcaagtatctctatctctctt |
35085466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 42795346 - 42795434
Alignment:
| Q |
1 |
gaaacaggtacgataagctgcttttct----caagtatctctatatctcttctactctccaagcgatacttatttatgtttgtaaaatca |
86 |
Q |
| |
|
||||||||| ||||||||| |||| || ||| ||||||||| |||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42795346 |
gaaacaggtgcgataagctactttactttatcaattatctctatctctcttatactctccaagcgatacttatttatg-ttgtaaaatca |
42795434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 268
Target Start/End: Original strand, 42795614 - 42795651
Alignment:
| Q |
231 |
ctctgctccttttatgagtgggaggcccatcccgtcat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42795614 |
ctctgctccttttatgagtgggaggcccatcccgtcat |
42795651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 42795502 - 42795554
Alignment:
| Q |
155 |
cgatgttgaggggtaattcagtgcgggtttataagtgttgtctggtttcgatt |
207 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
42795502 |
cgatgtggaggggtaactcagtgcgggtttataagtgttagctggtttcgatt |
42795554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 35085327 - 35085284
Alignment:
| Q |
164 |
ggggtaattcagtgcgggtttataagtgttgtctggtttcgatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
35085327 |
ggggtaattcagtgcgggtttataagtgtcgtctggtttggatt |
35085284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 43026940 - 43026983
Alignment:
| Q |
157 |
atgttgaggggtaattcagtgcgggtttataagtgttgtctggt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43026940 |
atgtggaggggtaattcagtgcgggtttataagtgtcgtctggt |
43026983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 26 - 68
Target Start/End: Original strand, 43026796 - 43026838
Alignment:
| Q |
26 |
ctcaagtatctctatatctcttctactctccaagcgatactta |
68 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
43026796 |
ctcaagtatctctatctctcttctactatccaagcgatactta |
43026838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 35100634 - 35100591
Alignment:
| Q |
164 |
ggggtaattcagtgcgggtttataagtgttgtctggtttcgatt |
207 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
35100634 |
ggggtaattcaatgcgggtttataagtgtcgtctggtttggatt |
35100591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University