View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21673_high_1 (Length: 281)
Name: NF21673_high_1
Description: NF21673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21673_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 260
Target Start/End: Original strand, 25703204 - 25703446
Alignment:
| Q |
18 |
ttttccatcttgatgaccggtgaagatgtttccttcggatataacaatggttttgaccaaaccactacttgatttaaaaccggtataatctttaagttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25703204 |
ttttccatcttgatgaccggtgaagatgtttccttcggatataacaatggatttgaccaaaccactacttgatttaaaaccggtataatctttaagttct |
25703303 |
T |
|
| Q |
118 |
ttccacacccttatgtttttgctatcggtaccggtgtataacatgtcaccggaaacggctaaggagtagatgtgaccttcttcgcgagctagtgacccga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25703304 |
ttccacacccttatgtttttgctatcggtaccggtgtataacatgtcaccggaaacggctaaggagtagatgtgaccttcttcgcgagctagtgacccga |
25703403 |
T |
|
| Q |
218 |
tgaggccattttccgggaaatagctgtcgttgtaattgttgtc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25703404 |
tgaggccattttccgggaaatagctgtcgttgtaattgttgtc |
25703446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University