View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21675_high_50 (Length: 302)
Name: NF21675_high_50
Description: NF21675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21675_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 22061544 - 22061830
Alignment:
| Q |
1 |
tcatccccagaaatacaatcttcaccagcgatctccatctctgatcagtttatcagcaaaacctccaattcatgctcctgttactcctccactccgataa |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22061544 |
tcatccccggaaatacaatcttcaccagcgatctccatctctgatcagtttatcagcaaaacctccaattcatgctcctgttactcctccactccgatat |
22061643 |
T |
|
| Q |
101 |
tccttccttcttcgcttcaacacctaaatccggccaattgtttctgacgataataccaaaggttcactcgccggcgatggatttcggtgttggattgtcg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22061644 |
tccttccttcttcgctccaacacctaaatccggccaattgtttctgacgataataccaaaggttcactcgccggcgatggatttcggtgttggattgtcg |
22061743 |
T |
|
| Q |
201 |
gcgaacccta----ttaattatatccaaaatggtgctaacatctttgacaaaatcatcatcccttagatgtaactgattactattct |
283 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22061744 |
gcgaaccctattcgttaattatatccaaaatggtgttaacatctttgacaaaatgatcatcccttagatgtaactgattactattct |
22061830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 213 - 283
Target Start/End: Complemental strand, 32904337 - 32904267
Alignment:
| Q |
213 |
aattatatccaaaatggtgctaacatctttgacaaaatcatcatcccttagatgtaactgattactattct |
283 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
32904337 |
aattatatccaaaatggtcttaacatctttgacaaaaccatcatcccttaaatgtaactgactactattct |
32904267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University