View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21676_high_23 (Length: 323)
Name: NF21676_high_23
Description: NF21676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21676_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 9 - 172
Target Start/End: Original strand, 37483643 - 37483804
Alignment:
| Q |
9 |
agcacagaccataaactctatcagtcaaacaccaaaaacaaatacaatttaagtctctgcgcaattatagagtgttttggttttagtccctgtaagnnnn |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37483643 |
agcacagaccataaactctatcaatcaaacaccaaaaacaaatacaatttaagtctctgc--aattatagagtgttttggttttagtccctgtaagtttt |
37483740 |
T |
|
| Q |
109 |
nnngtttcaactcagtccctgcaaatttaaaacaagagtttttgaatttgcaggaaccgaatac |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37483741 |
tttgtttcaactcagtccctgcaaatttaaaacaagagtttttgaatttgcaggaaccgaatac |
37483804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 210 - 323
Target Start/End: Original strand, 37483843 - 37483955
Alignment:
| Q |
210 |
cactataattgcggaaactagaatcatgaataacactataattgcggaaacttaaataataccaagatcataaacaacaggtctacttccagatttgcgt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37483843 |
cactataattgcggaaactagaatcatgaataacactataatt-cggaaacttaaataataccaagatcataaacaacaggtctacttccagatttgcgt |
37483941 |
T |
|
| Q |
310 |
aagtgaggactatt |
323 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37483942 |
aagtgaggactatt |
37483955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University