View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21677_high_15 (Length: 304)
Name: NF21677_high_15
Description: NF21677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21677_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 9 - 163
Target Start/End: Original strand, 29487534 - 29487688
Alignment:
| Q |
9 |
agcagagagttgtggtggacgggacgatttatcggttgtcacgatgatactctttttctataatttagtttcgtgttcgcatgcagatgcgttgaattgt |
108 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
29487534 |
agcagagagttgtggtggacgggtcgatttatcggttgtcacgatgatactctttttttataatttagtttcgtgttcgtatgttgatgcgttgaattgt |
29487633 |
T |
 |
| Q |
109 |
gcacgtgatgtgtgattgttcgccttattttagatttgactctctactcttcaag |
163 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
29487634 |
gcacgtgacgtgtgattgttcgccttattttggatttgactctctacccttcaag |
29487688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 252 - 304
Target Start/End: Original strand, 29487777 - 29487829
Alignment:
| Q |
252 |
tatttgtttcttggttacaaaatttatggttgggattaaattttctaggaata |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
29487777 |
tatttgtttcttggttacaaaatttatggtcgggattaaattttttaggaata |
29487829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University