View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21679_high_10 (Length: 359)
Name: NF21679_high_10
Description: NF21679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21679_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Complemental strand, 9306200 - 9305840
Alignment:
| Q |
1 |
gcttccaaagtgtcaaaggctcttccatg---gtgttctagatttgaaccaccatcaccagattctgactttgccacagaattactttcagtttgtttca |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9306200 |
gcttccaaagtgtcaaaggctcttccatgctggtgttctagatttgaaccaccatcaccagattctgactttgccacagaattactttcagtttgtttca |
9306101 |
T |
|
| Q |
98 |
tattagtgtcagctttaatagaagcattagcagataaacttgaagaccattcttgatttaagacagtccaaggatttgatgaagtagaaattggtgcttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9306100 |
tattagtgtcagctttaatagaagcattagcagatgaacttgaagaccattcttgatttaagacagtccaaggatttgatgaagtagaaattggtgcttc |
9306001 |
T |
|
| Q |
198 |
tttcttccaaatagatgattgaatatttgcacaatcagtagtcccctcttgatcatcccaagaatcttctctacaagctggttctataataacagcctgt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9306000 |
tttcttccaaatagatgattgaatatttgcacaatcagtagtcccctcttgatcatcccaagaatcttctctacaagctggttctataataacagcctgt |
9305901 |
T |
|
| Q |
298 |
ttccacatataacccgtcaatgttgtcagcgcaccgcctttcactgtctctgctcctcctc |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9305900 |
ttccacatataacccgtcaatgttgtcagcgcaccgcctttcactgtctcagctcctcctc |
9305840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University