View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21679_high_19 (Length: 326)
Name: NF21679_high_19
Description: NF21679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21679_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 30837006 - 30836902
Alignment:
| Q |
1 |
ctcccaattccaaatttcttaactttcactgctttttcccccaaattcctttctgggtatccttatttttctttctctcatgttttctgcttagttcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30837006 |
ctcccaattccaaatttcttaactttcactgctttttcccccaaattcctttctgggtatccttatttttctttctctcatgttttctgcttagttcaag |
30836907 |
T |
|
| Q |
101 |
gtaac |
105 |
Q |
| |
|
||||| |
|
|
| T |
30836906 |
gtaac |
30836902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 264 - 316
Target Start/End: Complemental strand, 30836726 - 30836668
Alignment:
| Q |
264 |
acctgtgaaattctgcttatta------cattgtgttattgtaatgtaattgttctgtg |
316 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30836726 |
acctgtgaaattctgcttattagaaatacattgtgttattgtaatgtaattgttctgtg |
30836668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University