View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21679_high_6 (Length: 386)
Name: NF21679_high_6
Description: NF21679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21679_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 1 - 360
Target Start/End: Original strand, 7876254 - 7876613
Alignment:
| Q |
1 |
acaacaaactcatacctatctgatgaagaagaacctttcagttgatgatccttgaaccccacgtcagaagaagacccttgatcagttttcacaactttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7876254 |
acaacaaactcatacctatctgatgaagaagaacctttcagttgatgatccttgaacaccacgtcagaagaagacccttgatcagttttcacaactttgt |
7876353 |
T |
 |
| Q |
101 |
ccaaattattattatcattaacactttctgaaccttttttctccatgctagcgtcaatgctcatgtcactactaccactccaccgccggaatacgtcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7876354 |
ccaaattattattatcattaacactttctgaaccttttttctccatgctagcgtcaatgctcatgtcactactaccactccaccgccggaatacgtcaga |
7876453 |
T |
 |
| Q |
201 |
ggacattctccgaagctcgaccggctttccagtattttctttttgcttcttttcaaacaaattgattctgtcttgtacactgagtcgtcgccctaccggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7876454 |
ggacattctccgaagctcgaccggctttccagtattttctttttgcttcttttcaaacaaattgattctgtcttgtacactgagtcgtcgccctgccggt |
7876553 |
T |
 |
| Q |
301 |
gccggcgttggtgatgacggcaacggcgttggcgacgactcggtctgttctttattgctg |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7876554 |
gccggcgttggtgatgacggcaacggcgttggcgacgagtcggtctgttctttattgctg |
7876613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University