View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2167_high_10 (Length: 238)
Name: NF2167_high_10
Description: NF2167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2167_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 220
Target Start/End: Original strand, 37996288 - 37996488
Alignment:
| Q |
20 |
tctataatgtaaacaatgcgtgtgcgttgaggataatcacgatatgaagcactaaaataacacaaatttttgcttaaacgagcaatgagtaatggcaaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37996288 |
tctataatgtaaacaatgcgtgtgcgttgaggataatcacgatatgaagcactaaaataacacaaatttttgcttacacgagcaatgagtaatggcaaaa |
37996387 |
T |
 |
| Q |
120 |
tgcaagttgcgtggtcctacaattacaaggactcatatataacccacaaaaccatgtgccttattctttccaccaacaatactagatcacccccacagcc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
37996388 |
tgcaagttgcgtggtcctacaattacaaggactcatatataacccacaaaaccatgtgccttattctttcaactaacaatactagatcacccccacagcc |
37996487 |
T |
 |
| Q |
220 |
t |
220 |
Q |
| |
|
| |
|
|
| T |
37996488 |
t |
37996488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University