View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2167_high_13 (Length: 224)
Name: NF2167_high_13
Description: NF2167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2167_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 207
Target Start/End: Complemental strand, 18258518 - 18258332
Alignment:
| Q |
21 |
gtctggctgatattttcgaatcaatgtcaaagcttgcgtgcaatcagatctgcaactaatttgtttataaccatattcccaggcaaataataatccatgc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18258518 |
gtctggctgatattttcgaatcaatgtcaaagcttgcgtgcaatcagatctgcaactaatttgtttataaccatattcccaagcaaataataatccatgc |
18258419 |
T |
|
| Q |
121 |
tttatagcttcgagctctgcttccaagctattagcaaaccctatagcaaactctataggcccactaaatcctctaagccattcgcct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18258418 |
tttatagcttcgagctctgcttccaagctattagcaaaccctatagcaaactctataggcccactaaatcctctaagccattcgcct |
18258332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University