View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2167_low_12 (Length: 252)
Name: NF2167_low_12
Description: NF2167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2167_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 42250092 - 42249847
Alignment:
| Q |
1 |
aaaataaaaattcaacattgatcaaataa-caaaacaattgcatatattcttttattaactaaacatactctccattgctaagtagggggtacttattta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42250092 |
aaaataaaaattcaacattgatcaaataaacaaaacaattgcatatattcttttattaactaaacatactctccattgctaagtagggggtacttattta |
42249993 |
T |
|
| Q |
100 |
acacgaatgctaatgatacgctctcaacaagttacttattcaacacgatcttaatcaggggaaataaccctccattgtaaacgttctgaataaattgatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42249992 |
acacgaatgctaatgatacgctctcaacaagttacttattcaacacgatcttaatcaggggaaataaccctccattgtaaacgttctgaataaattgatt |
42249893 |
T |
|
| Q |
200 |
gaacacaaatgttaaaatgttttacacatgttatttattttcttcg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42249892 |
gaacacaaatgttaaaatgttttacacatgttatttatttttttcg |
42249847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University