View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2167_low_16 (Length: 237)
Name: NF2167_low_16
Description: NF2167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2167_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 32075452 - 32075232
Alignment:
| Q |
1 |
ttacactattggccctaccatacctaagtttagccttattaaaaacaatccaaaaccgagtaacactaatcatagctactacattgagtggctagattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32075452 |
ttacactattggccctaccatacctaagtttagccttattaaaaacgatccaaaaccgagtaacactaatcatagctactacattgagtggctagattca |
32075353 |
T |
|
| Q |
101 |
caacctattggttcagttctttatattgcacaaggaagttttttctcggtttcaagtgcacaaattgatgagattgcagctgctttgtgtgcaagcaatg |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32075352 |
caacctattggttctgttctttatattgcacaaggaagttttttctcggtttcaagtgcacaaattgatgagattgcagctgctttgtgtgcaagcaatg |
32075253 |
T |
|
| Q |
201 |
ttcggttcttatggatagcac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32075252 |
ttcggttcttatggatagcac |
32075232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 79 - 219
Target Start/End: Original strand, 31005633 - 31005773
Alignment:
| Q |
79 |
ctacattgagtggctagattcacaacctattggttcagttctttatattgcacaaggaagttttttctcggtttcaagtgcacaaattgatgagattgca |
178 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| |||||||| || |||||||| ||||||||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
31005633 |
ctacattgagtggctagattcacaacccactggttctgttctttacatagcacaaggtagttttttctcagcttcaagtgaacaaattgatgagattgca |
31005732 |
T |
|
| Q |
179 |
gctgctttgtgtgcaagcaatgttcggttcttatggatagc |
219 |
Q |
| |
|
||||||||||| |||||||||| | || |||||| |||| |
|
|
| T |
31005733 |
aatgctttgtgtgaaagcaatgttagatttttatgggtagc |
31005773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University