View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2167_low_18 (Length: 224)

Name: NF2167_low_18
Description: NF2167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2167_low_18
NF2167_low_18
[»] chr3 (1 HSPs)
chr3 (21-207)||(18258332-18258518)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 207
Target Start/End: Complemental strand, 18258518 - 18258332
Alignment:
21 gtctggctgatattttcgaatcaatgtcaaagcttgcgtgcaatcagatctgcaactaatttgtttataaccatattcccaggcaaataataatccatgc 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
18258518 gtctggctgatattttcgaatcaatgtcaaagcttgcgtgcaatcagatctgcaactaatttgtttataaccatattcccaagcaaataataatccatgc 18258419  T
121 tttatagcttcgagctctgcttccaagctattagcaaaccctatagcaaactctataggcccactaaatcctctaagccattcgcct 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18258418 tttatagcttcgagctctgcttccaagctattagcaaaccctatagcaaactctataggcccactaaatcctctaagccattcgcct 18258332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University