View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2167_low_21 (Length: 206)

Name: NF2167_low_21
Description: NF2167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2167_low_21
NF2167_low_21
[»] chr4 (1 HSPs)
chr4 (18-110)||(21268748-21268840)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 21268840 - 21268748
Alignment:
18 aggagtgtgagaaaaatgatacctttgatactgttaaggtgtttggttactttgttagcgcaaccttcgcaatgcatatagactttcaaaacc 110  Q
    ||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
21268840 aggagtgtgagaaaaatgatacctttgatgccgttaaggtgtttggtgactttgttagcgcaaccttcgcaatgcatatagactttcaaaacc 21268748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University