View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21680_high_7 (Length: 378)
Name: NF21680_high_7
Description: NF21680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21680_high_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 28 - 378
Target Start/End: Complemental strand, 52518481 - 52518131
Alignment:
| Q |
28 |
atgttttctggatataaatggttttctagttggatgggaccaggcactgtggtaaacaaattatggcttagcagtgcagtctcagcatctagttttgcat |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518481 |
atgttttctggatataaatggttttctagttggatgggaccaggcactgtggtaaacaaattatggcttagcagtgcagtctcagcatctagttttgcat |
52518382 |
T |
|
| Q |
128 |
ttttggagatactatacactattaatgccatttacttgtataactttgcaacttcaaaaaacatttggaattttattgcaggattcctgttattggggga |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518381 |
ttttggagatactatacactattaatgccatttacttgtataactttgcaacttcaaaaaacatttggaattttattgcaggattcctgttattggggga |
52518282 |
T |
|
| Q |
228 |
agggaattggatttacatcgcctctttgttgaagtgacttctcgtggtgggtttgaaaaagtaagatgtaattataatttcaatattgttggtatgaatg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518281 |
agggaattggatttacatcgcctctttgttgaagtgacttctcgtggtgggtttgaaaaagtaagatgtaattataatttcaatattgttggtatgaatg |
52518182 |
T |
|
| Q |
328 |
catggacaccgacgccaaacattgcgtgaatatgtagacactgatgatgtc |
378 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518181 |
catggacaccgatgccaaacattgcgtgaatatgtagacactgatgatgtc |
52518131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University