View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21683_high_10 (Length: 388)
Name: NF21683_high_10
Description: NF21683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21683_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 366
Target Start/End: Complemental strand, 14997011 - 14996646
Alignment:
| Q |
1 |
ccaccactacttcccttttcttccccaacccatttacctctcaaaccaacaagaaaagactaaccgccaagaagaacctcctcaccctcatctctgacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14997011 |
ccaccactacttcccttttcttccccaacccattcacctctcaaaccaacaagaaaagactaaccgccaagaagaacctcctcaccctcatctctgacca |
14996912 |
T |
|
| Q |
101 |
agaccgtggcctcaagacccnnnnnnnccccaccaagctagcatcgatcgttaccgcgatcgatgcaatggccgagcttggcaccggtacagtaaccacc |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14996911 |
agaccgtggcctcaagacccaaaaaaatcccaccaagctagcttcgatcgttaccgcgatcgatgcaatggccgagcttggcaccggtttagtaaccacc |
14996812 |
T |
|
| Q |
201 |
ggcgattccctgtcggcaacttggcggttgctctggactactgagaaggagcagctgttcatcattgagaaggctggcttgtttggaactaaaactggtg |
300 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14996811 |
ggtgattccctgtcggcaacttggcggttgctctggactactgagaaagagcagctgttcatcattgagaaggctggcttgtttggaactaaaactggtg |
14996712 |
T |
|
| Q |
301 |
atgttttacaggtcattgacgttaagaatttgagtctgaacaatgttattacttttcctcctgatg |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14996711 |
atgttttacaggtcattgacgttaagaatttgagtcttaacaatgttattacttttcctcctgatg |
14996646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University