View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21683_high_32 (Length: 317)
Name: NF21683_high_32
Description: NF21683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21683_high_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 16 - 293
Target Start/End: Original strand, 50654274 - 50654550
Alignment:
| Q |
16 |
gatggacatcatcacccttctaccccagtcnnnnnnngtataggatgagagaatggaataacataggttataaacttggtggcttctaaggtgagagagc |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50654274 |
gatgaacatcatcacccttctaccccagtcaaaaaaagtataggatgagagaatggaataacataggttataaacttggtggcaga-aaggtgagagagc |
50654372 |
T |
|
| Q |
116 |
catcaagttcctcaccagtgtactattggatctattaaaataattaaagggttcagatatattaaaaaattaagagtagcacataagtcttccctcaccc |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654373 |
catcaagttcctcaccagtgtaccattggatctattaaaataattaaagggttcagatatattaaaaaattaagagtagcacataagtcttccctcaccc |
50654472 |
T |
|
| Q |
216 |
aatccctccttgtttaactctttccctgctaaaccttccttgttatgatgtcttcaccttcaatttacgccactgact |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654473 |
aatccctccttgtttaactctttccctgctaaaccttccttgttatgatgtcttcaccttcaatttacgccactgact |
50654550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University